Review



plko 3 thy1 1 cd90 1 vector  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91

    Structured Review

    Addgene inc plko 3 thy1 1 cd90 1 vector
    Plko 3 Thy1 1 Cd90 1 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+3/pPD95_03+(Plasmid+%231479)/pm41826695-319-18-22
    Average 91 stars, based on 4 article reviews
    plko 3 thy1 1 cd90 1 vector - by Bioz Stars, 2026-09
    91/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: Highly networked immunogen composition
    Article Snippet: .. Non-limiting examples of lentiviral vectors include pLVX-EF1alpha-AcGFP1-C1 (Clontech Catalog #631984), pLVX-EF1alpha-IRES-mCherry (Clontech Catalog #631987), pLVX-Puro (Clontech Catalog #632159), pLVX-IRES-Puro (Clontech Catalog #632186), pLenti6/V5-DESTTM (Thermo Fisher), pLenti6.2/V5-DESTTM (Thermo Fisher), pLKO.1 (Plasmid #10878 at Addgene), pLKO.3G (Plasmid #14748 at Addgene), pSico (Plasmid #11578 at Addgene), pLJM1-EGFP (Plasmid #19319 at Addgene), FUGW (Plasmid #14883 at Addgene), pLVTHM (Plasmid #12247 at Addgene), pLVUT-tTR-KRAB (Plasmid #11651 at Addgene), pLL3.7 (Plasmid #11795 at Addgene), pLB (Plasmid #11619 at Addgene), pWPXL (Plasmid #12257 at Addgene), pWPI (Plasmid #12254 at Addgene), EF.CMV.RFP (Plasmid #17619 at Addgene), pLenti CMV Puro DEST (Plasmid #17452 at Addgene), pLenti-puro (Plasmid #39481 at Addgene), pULTRA (Plasmid #24129 at Addgene), pLX301 (Plasmid #25895 at Addgene), pHIV-EGFP (Plasmid #21373 at Addgene), pLV-mCherry (Plasmid #36084 at Addgene), pLionII (Plasmid #1730 at Addgene), pInducer10-mir-RUP-PheS (Plasmid #44011 at Addgene). ..

    Article Title: Methods and compositions for increasing protein expression and/or treating a haploinsufficiency disorder
    Article Snippet: .. Non-limiting examples of lentiviral vectors include pLVX-EF1alpha-AcGFP1-C1 (Clontech Catalog #631984), pLVX-EF1alpha-IRES-mCherry (Clontech Catalog #631987), pLVX-Puro (Clontech Catalog #632159), pLVX-IRES-Puro (Clontech Catalog #632186), pLenti6/V5-DESTTM (Thermo Fisher), pLenti6.2/V5-DESTTM (Thermo Fisher), pLKO.1 (Plasmid #10878 at Addgene), pLKO.3G (Plasmid #14748 at Addgene), pSico (Plasmid #11578 at Addgene), pLJM1-EGFP (Plasmid #19319 at Addgene), FUGW (Plasmid #14883 at Addgene), pLVTHM (Plasmid #12247 at Addgene), pLVUT-tTR-KRAB (Plasmid #11651 at Addgene), pLL3.7 (Plasmid #11795 at Addgene), pLB (Plasmid #11619 at Addgene), pWPXL (Plasmid #12257 at Addgene), pWPI (Plasmid #12254 at Addgene), EF.CMV.RFP (Plasmid #17619 at Addgene), pLenti CMV Puro DEST (Plasmid #17452 at Addgene), pLenti-puro (Plasmid #39481 at Addgene), pULTRA (Plasmid #24129 at Addgene), pLX301 (Plasmid #25895 at Addgene), pHIV-EGFP (Plasmid #21373 at Addgene), pLV-mCherry (Plasmid #36084 at Addgene), pLionII (Plasmid #1730 at Addgene), pInducer10-mir-RUP-PheS (Plasmid #44011 at Addgene). ..

    Article Title: CHD7 binds to insulators during neuronal differentiation
    Article Snippet: For the lentiviral vector containing a blasticidin resistance cassette, pLKO.1-blast (Addgene #26655), double-stranded oligos were ligated into the AgeI and EcoRI restriction sites. .. For the lentiviral vector expressing GFP, pLKO.3G (Addgene #14748), double-stranded oligo was cloned into the EcoRI and PacI restriction sites. ..

    Expressing:

    Article Title: An alternative cell cycle coordinates multiciliated cell differentiation
    Article Snippet: The pLenti-PGK-Neo-PIP-FUCCI 26 plasmid was obtained from Addgene (118616). .. For expression of NLS–GFP, cyclin D1–GFP or E2F7–GFP, the coding sequence of NLS was synthesized and mouse Ccnd1 (ENSMUST00000093962.5) or E2f7 were PCR-amplified (ENSMUST00000073781.12) and cloned with a sequence encoding a carboxy-terminal eGFP into pLKO.3G (Addgene, 14748) with the sgRNA expression cassette removed. .. Lentivirus was generated by transfecting 7.5 μg of each plasmid with 1.5 μg of pCMV-VSV-G (Addgene, 8454) and 6 μg of psPAX2 (Addgene, 12260) into a 10 cm plate of Lenti-X 293T cells (HEK 293T, Takara) at 70–80% confluence using Fugene 6 transfection reagent (Promega, E2691).

    Article Title: Thalamic NRXN1-Mediated Input to Human Cortical Progenitors Drives Upper Layer Neurogenesis
    Article Snippet: Viral particles were concentrated using Lenti-X Concentrator (Takara Bio, Cat. No. 631232) and resuspended in PBS prior to storage. .. To knockdown the expression of NRXN1 and NLGN1, pLKO.1 and pLKO.3G plasmids were obtained (Addgene, Cat. No. 10878, 14748). pLKO.1 was subsequently modified by removing the puroR sequence and replaced with mCherry via NEBuilder HiFi DNA Assembly reaction (New England Biolabs, Cat. No. E2621L). ..

    Article Title: CHD7 binds to insulators during neuronal differentiation
    Article Snippet: For the lentiviral vector containing a blasticidin resistance cassette, pLKO.1-blast (Addgene #26655), double-stranded oligos were ligated into the AgeI and EcoRI restriction sites. .. For the lentiviral vector expressing GFP, pLKO.3G (Addgene #14748), double-stranded oligo was cloned into the EcoRI and PacI restriction sites. ..

    Sequencing:

    Article Title: An alternative cell cycle coordinates multiciliated cell differentiation
    Article Snippet: The pLenti-PGK-Neo-PIP-FUCCI 26 plasmid was obtained from Addgene (118616). .. For expression of NLS–GFP, cyclin D1–GFP or E2F7–GFP, the coding sequence of NLS was synthesized and mouse Ccnd1 (ENSMUST00000093962.5) or E2f7 were PCR-amplified (ENSMUST00000073781.12) and cloned with a sequence encoding a carboxy-terminal eGFP into pLKO.3G (Addgene, 14748) with the sgRNA expression cassette removed. .. Lentivirus was generated by transfecting 7.5 μg of each plasmid with 1.5 μg of pCMV-VSV-G (Addgene, 8454) and 6 μg of psPAX2 (Addgene, 12260) into a 10 cm plate of Lenti-X 293T cells (HEK 293T, Takara) at 70–80% confluence using Fugene 6 transfection reagent (Promega, E2691).

    Article Title: Thalamic NRXN1-Mediated Input to Human Cortical Progenitors Drives Upper Layer Neurogenesis
    Article Snippet: Viral particles were concentrated using Lenti-X Concentrator (Takara Bio, Cat. No. 631232) and resuspended in PBS prior to storage. .. To knockdown the expression of NRXN1 and NLGN1, pLKO.1 and pLKO.3G plasmids were obtained (Addgene, Cat. No. 10878, 14748). pLKO.1 was subsequently modified by removing the puroR sequence and replaced with mCherry via NEBuilder HiFi DNA Assembly reaction (New England Biolabs, Cat. No. E2621L). ..

    Synthesized:

    Article Title: An alternative cell cycle coordinates multiciliated cell differentiation
    Article Snippet: The pLenti-PGK-Neo-PIP-FUCCI 26 plasmid was obtained from Addgene (118616). .. For expression of NLS–GFP, cyclin D1–GFP or E2F7–GFP, the coding sequence of NLS was synthesized and mouse Ccnd1 (ENSMUST00000093962.5) or E2f7 were PCR-amplified (ENSMUST00000073781.12) and cloned with a sequence encoding a carboxy-terminal eGFP into pLKO.3G (Addgene, 14748) with the sgRNA expression cassette removed. .. Lentivirus was generated by transfecting 7.5 μg of each plasmid with 1.5 μg of pCMV-VSV-G (Addgene, 8454) and 6 μg of psPAX2 (Addgene, 12260) into a 10 cm plate of Lenti-X 293T cells (HEK 293T, Takara) at 70–80% confluence using Fugene 6 transfection reagent (Promega, E2691).

    Polymerase Chain Reaction:

    Article Title: An alternative cell cycle coordinates multiciliated cell differentiation
    Article Snippet: The pLenti-PGK-Neo-PIP-FUCCI 26 plasmid was obtained from Addgene (118616). .. For expression of NLS–GFP, cyclin D1–GFP or E2F7–GFP, the coding sequence of NLS was synthesized and mouse Ccnd1 (ENSMUST00000093962.5) or E2f7 were PCR-amplified (ENSMUST00000073781.12) and cloned with a sequence encoding a carboxy-terminal eGFP into pLKO.3G (Addgene, 14748) with the sgRNA expression cassette removed. .. Lentivirus was generated by transfecting 7.5 μg of each plasmid with 1.5 μg of pCMV-VSV-G (Addgene, 8454) and 6 μg of psPAX2 (Addgene, 12260) into a 10 cm plate of Lenti-X 293T cells (HEK 293T, Takara) at 70–80% confluence using Fugene 6 transfection reagent (Promega, E2691).

    Clone Assay:

    Article Title: An alternative cell cycle coordinates multiciliated cell differentiation
    Article Snippet: The pLenti-PGK-Neo-PIP-FUCCI 26 plasmid was obtained from Addgene (118616). .. For expression of NLS–GFP, cyclin D1–GFP or E2F7–GFP, the coding sequence of NLS was synthesized and mouse Ccnd1 (ENSMUST00000093962.5) or E2f7 were PCR-amplified (ENSMUST00000073781.12) and cloned with a sequence encoding a carboxy-terminal eGFP into pLKO.3G (Addgene, 14748) with the sgRNA expression cassette removed. .. Lentivirus was generated by transfecting 7.5 μg of each plasmid with 1.5 μg of pCMV-VSV-G (Addgene, 8454) and 6 μg of psPAX2 (Addgene, 12260) into a 10 cm plate of Lenti-X 293T cells (HEK 293T, Takara) at 70–80% confluence using Fugene 6 transfection reagent (Promega, E2691).

    Article Title: CHD7 binds to insulators during neuronal differentiation
    Article Snippet: For the lentiviral vector containing a blasticidin resistance cassette, pLKO.1-blast (Addgene #26655), double-stranded oligos were ligated into the AgeI and EcoRI restriction sites. .. For the lentiviral vector expressing GFP, pLKO.3G (Addgene #14748), double-stranded oligo was cloned into the EcoRI and PacI restriction sites. ..

    Knockdown:

    Article Title: Thalamic NRXN1-Mediated Input to Human Cortical Progenitors Drives Upper Layer Neurogenesis
    Article Snippet: Viral particles were concentrated using Lenti-X Concentrator (Takara Bio, Cat. No. 631232) and resuspended in PBS prior to storage. .. To knockdown the expression of NRXN1 and NLGN1, pLKO.1 and pLKO.3G plasmids were obtained (Addgene, Cat. No. 10878, 14748). pLKO.1 was subsequently modified by removing the puroR sequence and replaced with mCherry via NEBuilder HiFi DNA Assembly reaction (New England Biolabs, Cat. No. E2621L). ..

    Modification:

    Article Title: Thalamic NRXN1-Mediated Input to Human Cortical Progenitors Drives Upper Layer Neurogenesis
    Article Snippet: Viral particles were concentrated using Lenti-X Concentrator (Takara Bio, Cat. No. 631232) and resuspended in PBS prior to storage. .. To knockdown the expression of NRXN1 and NLGN1, pLKO.1 and pLKO.3G plasmids were obtained (Addgene, Cat. No. 10878, 14748). pLKO.1 was subsequently modified by removing the puroR sequence and replaced with mCherry via NEBuilder HiFi DNA Assembly reaction (New England Biolabs, Cat. No. E2621L). ..

    shRNA:

    Article Title: Thalamic NRXN1-Mediated Input to Human Cortical Progenitors Drives Upper Layer Neurogenesis
    Article Snippet: .. Insertion of shRNA sequences into the pLKO.1 and pLKO.3G backbone were performed according to the manufacturer’s instructions from Addgene. .. NRXN1 and NLGN1 shRNA sequences were designed using the Broad Institute Genetic Perturbation Platform Web Portal.



    Similar Products

    91
    Addgene inc plko 3 thy1 1 cd90 1 vector
    Plko 3 Thy1 1 Cd90 1 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+3/pPD95_03+(Plasmid+%231479)/pm41826695-319-18-22
    Average 91 stars, based on 1 article reviews
    plko 3 thy1 1 cd90 1 vector - by Bioz Stars, 2026-09
    91/100 stars
      Buy from Supplier

    93
    Addgene inc plko 3
    Plko 3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+3/pLKO%2E3G+(Plasmid+%2314748)/us12551547-314-33-37
    Average 93 stars, based on 1 article reviews
    plko 3 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc thy1 1 plasmid
    Thy1 1 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+3/pLKO%2E3+Thy1%2E1+(Plasmid+%2314749)/pmc12703964-94-1-5
    Average 93 stars, based on 1 article reviews
    thy1 1 plasmid - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc paper n a plko 3
    Paper N A Plko 3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+3/pLKO%2E3G+(Plasmid+%2314748)/pm41027427-222-94-105
    Average 93 stars, based on 1 article reviews
    paper n a plko 3 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    94
    Addgene inc cagacgcgtttagccctcccacacataaccaga 3
    Cagacgcgtttagccctcccacacataaccaga 3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+3/pLKO%2E1-blast+(Plasmid+%2326655)/pmc12231572-119-15-21
    Average 94 stars, based on 1 article reviews
    cagacgcgtttagccctcccacacataaccaga 3 - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    Addgene inc caga cgcgttta gccctccca ca ca t aa cca ga 3
    Caga Cgcgttta Gccctccca Ca Ca T Aa Cca Ga 3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+3/pLKO%2E1-blast+(Plasmid+%2326655)/pm40613708-75-22-39
    Average 94 stars, based on 1 article reviews
    caga cgcgttta gccctccca ca ca t aa cca ga 3 - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    93
    Addgene inc 26701 5 cctaaggttaagtcgccctcg 3
    26701 5 Cctaaggttaagtcgccctcg 3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+3/pLKO%2E1-blast-SCRAMBLE+(Plasmid+%2326701)/bio_rxiv__2025__06__23__661091-151-38-37
    Average 93 stars, based on 1 article reviews
    26701 5 cctaaggttaagtcgccctcg 3 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    Image Search Results